KU Natural History Museum

KU Natural History Museum The University of Kansas Natural History Museum, part of the Biodiversity Institute, has four floors of exhibits from microbes to mosasaurs, live events, educational opportunities, and more. Our researchers study the life of the planet on all continents.
(75)

We're thrilled to see KU Film and Media Studies student Nathan Shapiro's thoughtful short film, "The Deepest Green" in t...
05/09/2020

We're thrilled to see KU Film and Media Studies student Nathan Shapiro's thoughtful short film, "The Deepest Green" in the 2020 FMS Student Showcase! Shapiro was part of a KU Study Abroad & Global Engagement biodiversity class in 2019 taught by Dr. Andrew Short, curator of entomology. Shapiro was able to accompany the class thanks to a special Rudkins Scholars Fund through the KU BI/Natural History Museum, which supports a non-biology student accompanying an expedition team. Five KU undergraduate students were in the class, along with four students from the University of Suriname and staff from the National Zoological Collection of Suriname. The students were trained in tropical fieldwork and a wide range of collecting techniques. Congratulations Nathan!

🎥 View the film: https://youtu.be/jHaY8ObaT10?t=13

The 2020 FMS Student Showcase is now LIVE! Go to https://film.ku.edu/recognition-showcase to see all the hard work our students have done and to celebrate their accomplishments this year!

Sending a very special congratulations to our 2020 Graduates!!!

#Celebrate #Showcase #KUFMS #filmfun 🎥🎬🤩❤️🤸‍♀️🎉

Our iNaturalist.org project for May, a Backyard Biodiversity Blitz of Lawrence, has clocked in observances of over 90 sp...
05/08/2020
Backyard Biodiversity Blitz

Our iNaturalist.org project for May, a Backyard Biodiversity Blitz of Lawrence, has clocked in observances of over 90 species since it began on May 1! Join us in documenting the fauna and flora in Lawrence backyards, or while you're on a social-distance-safe walk. It's easy to join the project and all you need is to download the free iNaturalist app & look for the project "Backyard Biodiversity Blitz."


🌿Explore the project, the variety of species and more at: https://www.inaturalist.org/projects/backyard-biodiversity-blitz

Be a citizen scientist in Lawrence, Kansas! Help us celebrate Biodiversity Month by documenting wild flora & fauna throughout the month of May. Be sure to follow health & safety guidelines while on socially-distant nature walks during the COVID-19 pandemic. Your backyard, and even your home,...

05/05/2020

Join me for Story Book Science, THIS Wednesday on Facebook at 10am! I’ll be reading “Wisdom, The Midway Albatross” written by Darcy Pattison and illustrated by Kitty Harvill with permission from Mims House.

If you want to learn more about this book, you can view the book page on Mims House’s website: https://mimshousebooks.com/collections/picture-books/products/wisdom.

Join us for Story Book Science this Wed. at 10am right here on our page! Colleen will reading the incredible st...
05/05/2020

Join us for Story Book Science this Wed. at 10am right here on our page! Colleen will reading the incredible story of Wisdom the Midway Albatross, by Darcy Pattison (Mims House publishers). She'll also share information about the ocean, special bird adaptations & much more! Hope you can join us!

https://www.facebook.com/events/2510107392571675/

Lawrence Public Schools Usd 497
Kansas City, Kansas Public Schools
Explore Lawrence

Congratulations to Dr. Agusto, Ecology and Evolutionary Biology, Dr. Peterson, KU EEB and KU Biodiversity Institute & Na...
05/04/2020
Team models public-health strategies to stem COVID-19

Congratulations to Dr. Agusto, Ecology and Evolutionary Biology, Dr. Peterson, KU EEB and KU Biodiversity Institute & Natural History Museum, and Dr. Saint Onge, Department of Sociology, University of Kansas on receiving this important National Science Foundation (NSF) RAPID grant for COVID-19 research. They will use modeling to examine human behavior, demographics and other factors, which may help inform policy-makers.

“The first model is our baseline model to incorporate human behavior,” Agusto said. “You can see it as the foundation that we’re building up on top of. On the second model, we incorporate demographics — the number of seniors we have, the number of adults we have, the number of young adults we have, the number of kids we have— and throw that into the model.”

The third model will use the preceding behavior and demographic models to analyze regional-control efforts, focusing on states and then to national-level control efforts."

READ MORE:
https://news.ku.edu/2020/04/29/researchers-model-efforts-control-coronavirus-pandemic-new-nsf-rapid-award

Click for more on new NSF RAPID grant

Join us in documenting the flora and fauna of Lawrence in your own yard or if you go on a social-distance-safe walk! We ...
05/02/2020

Join us in documenting the flora and fauna of Lawrence in your own yard or if you go on a social-distance-safe walk! We have a new iNaturalist.org project for the month of May, created by our Outreach and Engagement Coordinator, Eleanor Gardner: the Backyard Biodiversity Blitz! ➡️https://www.inaturalist.org/projects/backyard-biodiversity-blitz

It’s easy to join the project – just download the free iNaturalist app, look for “Projects” and join our “Backyard Biodiversity Blitz.” Detailed instructions are below, and a quick guide to using the iNaturalist app is in the comments. We can't wait to see what you find!

🌿 As always, feel free to tag us if you post images to social media, or send us your pics at [email protected]!

🐿 Join via the iNaturalist Phone App:
iPhone: Download the iNaturalist app, then click the “More” tab, then “Projects,” then search for our project title of “Backyard Biodiversity Blitz” and click the “join” button.

🐝 Android: Download the app, select the left side pull-down menu, then “Projects,” then search for our project title of “Backyard Biodiversity Blitz” and click the “join” button.

Photo: Bell's vireo, the top-spotted species of our project, as of 5/2/20. Credit: Andy Reago & Chrissy McClarren / Creative Commons

➡️ https://www.inaturalist.org/projects/backyard-biodiversity-blitz

Ecology and Evolutionary Biology
KU Ecology and Evolutionary Biology GSO
Hillcrest Elementary School-USD 497-Lawrence, KS
Lawrence Public Schools Usd 497
KU Environmental Studies Program
Kansas Biological Survey and KU Field Station

Meet KUMIP 491853, Oryctocephalus walcotti - a beautiful trilobite from the Cambrian of Utah, collected by the Gunther f...
05/01/2020

Meet KUMIP 491853, Oryctocephalus walcotti - a beautiful trilobite from the Cambrian of Utah, collected by the Gunther family! Thanks to Dr. Bruce Lieberman, our senior curator of invertebrate paleontology, for today's #FossilFriday pic!

05/01/2020
Spit Like an Archerfish Activity

Happy May Day! It's a great day to get out in the yard and try one of our #MuseumFromHome activities! In this new video, our Associate Director for Public Programs, Teresa MacDonald, shows you how to spit like an Archerfish!

Archerfishes have a specialized way of catching land-based prey such as insects. They spit a jet of water to knock their prey off of branches. Use a squirter toy or squeeze bottle to test your skills by being an archerfish. Downloadable instructions are in the comments section below. Find more KU Natural History Museum activities and explorations at https://biodiversity.ku.edu/nhm-at-home and on our YouTube page!

🐟 https://youtu.be/2W_ImbPfFOQ

Explore Lawrence
KC STEM Alliance

Archerfishes are a group of fishes with a specialized way of catching land-based prey such as insects. They spit a jet of water to knock their prey off of br...

04/30/2020
Pop Up Science: DNA!

To honor International DNA Day, April 25, Eleanor from the KU Natural History Museum shares some fun facts and shows you how to create a bracelet from a section of sunflower DNA code. Explore more activities at https://biodiversity.ku.edu/nhm-at-home.

Below, find snippets* of DNA code from a variety of different organisms:

Sunflower (Helianthus annuus)
tgagatgttagaaggtgcaaaatcaataggggccggagctgctacaattg

Grizzly bear (Ursus arctos)
atgaccaacatccgaaaaacccacccattagctaaaatcatcaacaactc

Chimpanzee (Pan troglodytes)
tgaccccgacacgcaaaattaacccactaataaaattaattaatcactca

African elephant (Loxodonta africana)
atgaccgacattcgaaaatctcatccttcactcaaaatgatgaataaatc

Monarch butterfly (Danaus plexippus)
gaggctaccaagtttccgatctgtaggagatgcattgaaagatcgtttcg

Apple tree (Malus domestica)
gaattcggcacgagaagaaacgaagagagagagagagagcaaaaatggtt

Brown trout (Salmo trutta)
ctttggctcactcttaggcttgtgtctagccacccaaattcttaccggac

Human (Homo sapiens)
tgaccccaatacgcaaaattaaccccctaataaaattaattaaccgctca

*from the American Museum of Natural History

04/30/2020
Make Your Own Plant Press

In celebration of Earth Day 2020, and in conjunction with the Watkins Museum of History's Earth Day 50th Birthday celebration, Eleanor Gardner from the KU Natural History Museum shared how to make a plant press from materials in your home! A list of materials you’ll need is below. We'd love to see what you make! Share your photos by tagging us on social media or email pics to us at: [email protected]

DIY Plant Press materials you’ll need:
-two or more books
-a plant
-rubber bands
-paper towels
-two pieces of cardboard
-a pen
-a notecard

Bonus Earth Day activity: Test your waste knowledge with our quiz game at https://bit.ly/testyourwasteknowledge

There's still time to register for today's free Mapping A Virus conversation & Q&A at 4:30pm with KU experts. This event...
04/28/2020
Panel: “Mapping a Virus”

There's still time to register for today's free Mapping A Virus conversation & Q&A at 4:30pm with KU experts. This event is presented by The Commons, the Institute for Policy & Social Research, and the KU Biodiversity Institute. We hope you can join us. REGISTER: https://thecommons.ku.edu/event/899

PANELISTS:
▪️Folashade Agusto, Ecology and Evolutionary Biology
▪️Donna K. Ginther, KU Institute for Policy & Social Research / Economics
▪️Jorge Soberón, KU Biodiversity Institute / Ecology & Evolutionary Biology
▪️A. Townsend Peterson, KU Biodiversity Institute / Ecology & Evolutionary Biology

READ MORE:
https://today.ku.edu/2020/04/27/mapping-virus-panel-will-demonstrate-modeling-and-translation-data-policy

KU experts will take part in a live Q&A on April 28

04/28/2020

Join me for Story Book Science, THIS Wednesday on Facebook at 10am! I’ll be reading “Walk on the Wild Side” by Nicholas Oldland with permission from Kids Can Press. I hope to see you then!

It's  #WorldTapirDay! Here's a pic of a Baird's tapir (Tapirus bairdii) from our Panorama. Tapirs, while looking a bit l...
04/27/2020

It's #WorldTapirDay! Here's a pic of a Baird's tapir (Tapirus bairdii) from our Panorama. Tapirs, while looking a bit like an anteater or a pig, are more closely related to other odd-toed ungulates like rhinos and donkeys. Adults can grow to almost 4 feet in height and weigh up to around 800 pounds! Tapirs are classified as endangered or vulnerable due mostly to poaching and habitat loss in their native countries of Mexico, Central America and northwestern South America. The Baird's tapir is the official national animal of Belize where it is sometimes referred to as a ‘mountain cow’.

04/25/2020
Pop Up Science online - DNA Day!

Happy DNA Day! 🧬 Every year on April 25th, biologists celebrate the anniversary of the day that the structure of DNA was published in a scientific journal. For this month's Pop Up Science (online) program, learn about DNA Day with Eleanor and make a bracelet from a section of 🌻DNA code.
🎥 https://www.youtube.com/watch?v=zo9zwv8tqyg

👉 Bracelet instructions can also be found at https://biodiversity.ku.edu/nhm-at-home

🌎 And to learn more about the cryogenic storage facility at the KU Natural History Museum & Biodiversity Institute, check out this blog post: https://biodiversity.ku.edu/tags/cryogenics

To honor International DNA Day, Eleanor from the KU Natural History Museum shares some fun facts and shows you how to create a bracelet from a section of sun...

While the rain in Lawrence eases off, consider joining our iNaturalist.org project, Lawrence Earth Week 2020 Safe Natura...
04/24/2020
Lawrence Earth Week 2020 Safe Nature Collaboration

While the rain in Lawrence eases off, consider joining our iNaturalist.org project, Lawrence Earth Week 2020 Safe Natural Collaboration, to document the flora and fauna in your yard or if you go on a social-distance-safe walk. If you'd like more info on using iNaturalist, we've put a guide in the comments section below. If you prefer not to use the iNaturalist app, feel free to send us pics of what you find at [email protected] and we'll share them! This project, led by our Outreach and Engagement Coordinator, Eleanor Gardner, concludes with the end of Earth Week, late Saturday.

If you use the app, here's how to join our project:

🌿Join via the iNaturalist Phone App:
iPhone: Download the iNaturalist app, then click the “More” tab, then “Projects,” then search for our project title of “Lawrence Earth Week 2020 Safe Nature Collaboration” and click the “join” button.

🐝Android: Download the app, select the left side pull-down menu, then “Projects,” then search for our project title of “Lawrence Earth Week 2020 Safe Nature Collaboration” and click the “join” button.

🐇https://www.inaturalist.org/projects/lawrence-earth-week-2020-safe-nature-collaboration

Honor Earth Week (April 19-25) in Lawrence, Kansas! Celebrate the beauty & power of nature by documenting local biodiversity in your own yard [or on a (social-distance) walk] while following federal & local government recommendations during the COVID-19 pandemic. The goal is to document wild...

Today's #FossilFriday is a beautiful trilobite, Kochina vestita, KUMIP 491827, from the Cambrian of Utah! Thanks to our ...
04/24/2020

Today's #FossilFriday is a beautiful trilobite, Kochina vestita, KUMIP 491827, from the Cambrian of Utah! Thanks to our Senior Curator of invertebrate paleontology, Bruce Lieberman, for today's great pic! Trilobites were marine arthropods that lived from about 521 million years ago to about 252 million years ago. They lived in the oceans, mostly crawling along the seabeds. 🦖

04/22/2020
Watkins Museum of History

Thank you to the Watkins Museum of History for featuring us during today's fabulous Earth Day celebration with so many great community partners! If you missed it, here's Eleanor, our Outreach and Engagement Coordinator, sharing info on native plants & showing you how to create your own plant press! 🌿🌍 Happy Earth Day!

Turn flowers, tree branches or other plants into this crafted piece of natural artwork!

04/22/2020
Watkins Museum of History

Be sure to visit the Watkins Museum of History's page today for the big #EarthDay50 Birthday celebration, continuing until 4pm! 🌍 Catch us on their FB page at 1pm, sharing native plant and pollinator info, plus we'll show you how to make your own plant press!
🌿https://www.facebook.com/WatkinsMuseum/

The Watkins Museum of History, administrated by the Douglas County Historical Society, encourages civic engagement by supporting the research and interpretation of county history through active exhibits and thought-provoking educational programs.

Celebrate Earth Week & do some citizen science with us all week (virtually) with iNaturalist.org! KU Natural History Mus...
04/21/2020
Lawrence Earth Week 2020 Safe Nature Collaboration

Celebrate Earth Week & do some citizen science with us all week (virtually) with iNaturalist.org! KU Natural History Museum Outreach & Engagement Coordinator, Eleanor, has created an iNaturalist project: 🌍Lawrence Earth Week 2020 Safe Nature Collaboration. Join us in documenting the local Lawrence, Kansas biodiversity through April 25, whether looking in your own yard, or while on a socially-distance-safe walk (so we can all follow federal & local government recommendations during the COVID-19 pandemic). Our goal is to document the wild species of flora and fauna in a way that allows us to safely connect with nature & each other. You can participate on desktop, or download the @iNaturalist app for your phone!

Join via desktop: https://www.inaturalist.org/projects/lawrence-earth-week-2020-safe-nature-collaboration

🌿Join via the iNaturalist Phone App:

iPhone: Download the iNaturalist app, then click the “More” tab, then “Projects,” then search for our project title of “Lawrence Earth Week 2020 Safe Nature Collaboration” and click the “join” button.

Android: Download the app, select the left side pull-down menu, then “Projects,” then search for our project title of “Lawrence Earth Week 2020 Safe Nature Collaboration” and click the “join” button.

👀We can't wait to see what everyone finds!

Honor Earth Week (April 19-25) in Lawrence, Kansas! Celebrate the beauty & power of nature by documenting local biodiversity in your own yard [or on a (social-distance) walk] while following federal & local government recommendations during the COVID-19 pandemic. The goal is to document wild...

04/21/2020

Join me for Story Book Science, THIS Wednesday on Facebook at 10am! I’ll be reading “Up the Creek” by Nicholas Oldland with permission from Kids Can Press. I hope to see you then!

Look 👀! We have a new Golden silk orb weaver spider (Trichonephila clavipes) at the museum! Greg, exhibit designer and o...
04/18/2020

Look 👀! We have a new Golden silk orb weaver spider (Trichonephila clavipes) at the museum! Greg, exhibit designer and official essential staffer, is looking after the spider at the museum until its new exhibit is built. Here, it's enjoying a delicious cricket lunch. A single thread of its anchor silk has a tensile strength greater than steel! 🕷

Visit our Museum From Home page and explore a variety of fun activities from exploring mammal skulls to creating your own nature journal:
🦖 https://biodiversity.ku.edu/nhm-at-home

We're sharing a special specimen for #FossilFriday... check out this extinct Peccary (Platygonus leptorhinus Williston, ...
04/17/2020

We're sharing a special specimen for #FossilFriday... check out this extinct Peccary (Platygonus leptorhinus Williston, or compressus) from the Pleistocene! This is a very early KU Natural History Museum vertebrate paleontology specimen, collected in 1893 in Goodland, Kansas. This is the same year our Panorama exhibit was displayed at the Chicago World's Fair! 🦖Thanks go to Dr. David Burnham for this week's Fossil Friday pics.

Here's a fun Historic Sites Bingo from our friends at the Watkins Museum of History! We're on the list - woohoo! How man...
04/15/2020

Here's a fun Historic Sites Bingo from our friends at the Watkins Museum of History! We're on the list - woohoo! How many places have you been to?

🌎 Looking forward to teaming up with Watkins next week on April 22 for the big Earth Day 50th Birthday Celebration, hosted on their FB page! 🦖

Historic Sites Bingo!
Can you say that you've been to all of these historic sites in Douglas County? Share this with your friends and then prove to us how many you been to by sharing a screenshot in the comments!

Freedom's Frontier National Heritage Area, Inc.
KU Natural History Museum
The University of Kansas
Eudora Area Historical Society
Baldwin City, KS - Municipal Government
Historic Lecompton
Haskell Indian Nations University
Haskell Cultural Center and Museum
Baker University Wetlands
Black Jack Battlefield and Nature Park
Guardians of Grover Barn
The Eldridge Hotel
Dole Institute of Politics
Wakarusa River Valley Heritage Museum
Liberty Hall
Friends of Oak Hill Cemetery
Kansas Jayhawks

Address

1345 Jayhawk Blvd
Lawrence, KS
66045

Opening Hours

Tuesday 09:00 - 17:00
Wednesday 09:00 - 17:00
Thursday 09:00 - 17:00
Friday 09:00 - 17:00
Saturday 09:00 - 17:00
Sunday 12:00 - 16:00

Telephone

(785) 864-4450

Alerts

Be the first to know and let us send you an email when KU Natural History Museum posts news and promotions. Your email address will not be used for any other purpose, and you can unsubscribe at any time.

Contact The Museum

Send a message to KU Natural History Museum:

Videos

Category

Microbes, mosasaurs, and more!

The University of Kansas Natural History Museum, part of the Biodiversity Institute, is home to four floors of public exhibits from microbes to mosasaurs. Explore the historic Panorama, live insects and snakes, vertebrate and invertebrate fossils, parasites, and the flora and fauna of the Great Plains. The museum provides content-rich, hands-on informal science learning for K–12, scouts, college students, and communities. The museum also offers a wide range of public programs and events for all age groups. The museum is open to all and admission is contribution-based. Members and volunteers are integral to the museum and information on both can be found on our website.

The KU Biodiversity Institute studies the life of the planet for the benefit of the Earth and its inhabitants. The institute and the museum accomplish this mission through the acquisition, curation, and study of collections of plants, animals, fossil material, and cultural artifacts for undergraduate, graduate, and public education, as well as research and public and professional service.

The Biodiversity Institute’s worldwide collections of almost 10 million specimens and 1.2 million archaeological artifacts encompass the study of archaeology, birds, reptiles, amphibians, fishes, mammals, plants, parasites, insects, fossil plants, and animals. More than 100 research scientists and graduate students study the species, ecosystems, evolution, and cultures of the planet. They use this information to model and forecast environmental phenomena that are critical to human well-being, including threatened and endangered species, the potential spread of diseases and pest species, and the effects of climate change on Earth’s biodiversity and habitats. Learn more at biodiversity.ku.edu


Comments

Dr. Rudy Sookbirsingh....
We invite you to attend a first of its kind discussion in Kansas. The event is open to scholars and the public. FREE. Refreshments will be served. Panelists Courtney Little Axe, Assistant Native American Graves Protection & Reparation Act Autry Museum of the American West, Los Angeles, CA. E. Felicia Cisneros, Graduate Student Global Policy;Arts & Cultural Management University of Texas, Austin, TX. Dr. Laura Murphy, Assistant Professor Sociology & Anthropology Department Washburn University, Topeka, KS. Daniel Bagheri Sarvestani, Ph.D. Candidate Anthropology Department University of Kansas, Lawrence, KS. https://www.facebook.com/events/836903970020003/
Took my two youngest children(14&6)to the museum for the first time while my 18-year-old and his dad were in meetings at KU today. We enjoyed it except for the 6-year-old who cried about the "creepy building with dead animals." I, for one, thought the building was fabulous! We will try again when he is older.
KU researchers investigated the site in Idaho. Great place to visit. It’s on BLM land.
My blog post about your wonderful museum!
Susan Magee Riordan have the kiddos seen this yet?
Epic: